Επιστήμη & Τεχνολογία Πώς λειτουργεί ο μηχανισμός των μεταλλάξεων

Πώς λειτουργεί ο μηχανισμός των μεταλλάξεων

-

Τον 1973, ο μεγάλος εξελικτικός βιολόγος Θεοδόσιος Ντομπζάνσκι (Theodosius Dobzhansky, 1900-1975) έγραψε ένα δοκίμιο με τίτλο «Nothing in biology makes sense except in the light of evolution». Πράγματι στη Βιολογία τίποτε δεν βγάζει νόημα εκτός αν το δούμε υπό το πρίσμα της εξέλιξης. Το ίδιο θα επιχειρήσουμε να κάνουμε και σήμερα προκειμένου να «βγάλουμε νόημα» για τον ιό, τα μεταλλαγμένα στελέχη του, την πιθανή επίδρασή τους στην αποτελεσματικότητα των εμβολίων και εν τέλει στη ζωή μας.

 DNA: Ενας παγκόσμιος κώδικας

Αν έπρεπε να επιλέξουμε ένα και μόνο επιχείρημα το οποίο να αποδεικνύει την εξελικτική θεωρία (διατυπώθηκε το 1859 από τον βρετανό φυσιοδίφη Κάρολο Δαρβίνο, 1809-1882), αυτό θα ήταν το γεγονός ότι όλοι οι οργανισμοί (από τους απλούστερους μονοκύτταρους μέχρι τους πολυπλοκότερους όπως ο άνθρωπος) διαθέτουν έναν κοινό γενετικό κώδικα, το DNA (δεοξυριβονουκλεϊνικό οξύ). Θα μπορούσαμε να  περιγράψουμε το DNA (αν και κάπως απλουστευτικά) σαν ένα πολυμερές τεσσάρων νουκλεϊνικών οξέων: της αδενίνης (Α), της θυμίνης (Τ), της γουανίνης (G) και της κυτοσίνης (C). Ετσι, όταν λέμε ότι οι βιολόγοι διαβάζουν την αλληλουχία ενός γονιδιώματος, εννοούμε στην πραγματικότητα ένα «κείμενο» χιλιάδων ή και εκατομμυρίων γραμμάτων χωρίς σημεία στίξης, το οποίο θα μπορούσε να είναι κάπως έτσι: ATGCTCTAACGGGATTGACAT…

Σε τι συνίσταται όμως ο γενετικός κώδικας; Ο γενετικός κώδικας αποτελεί τη συνταγή για τη δημιουργία ενός λειτουργικού οργανισμού και η εγγεγραμμένη στο DNA πληροφορία μεταφράζεται σε πρωτεΐνες, μόρια τα οποία εξασφαλίζουν τη δομή και την καλή λειτουργία των κυττάρων.

Ολες οι πρωτεΐνες των ζωντανών οργανισμών δομούνται από 20 διαφορετικά αμινοξέα, η σειρά των οποίων στο πρωτεϊνικό μόριο καθορίζεται από τη σειρά των γραμμάτων στο DNA. Τρία συνεχόμενα γράμματα του DNA καθορίζουν την ταυτότητα ενός αμινοξέος. Ετσι τα 21 γράμματα στο DNA του παραδείγματός μας αντιστοιχούν στα 7 πρώτα αμινοξέα μιας πρωτεΐνης.

Ιοί: πάντα με τον ξενιστή τους

Τι σχέση έχουν όμως τα παραπάνω με τον ιό; Κατ’ αρχάς να διευκρινίσουμε ότι ορισμένοι ιοί, του SARS-CoV-2 συμπεριλαμβανομένου, είναι ιοί RNA. Το RNA (ριβονουλκεϊνικό οξύ) μοιάζει με το DΝΑ, μόνο που αντί για θυμίνη φέρει ένα άλλο νουκλεοτίδιο, την oυρακίλη (U). Στην πράξη όμως δεν αλλάζει τίποτε άλλο ως προς την κωδικοποίηση. Γι’ αυτό εξάλλου οι ιοί μπορούν να αξιοποιούν τα δικά μας κύτταρα προκειμένου να πολλαπλασιαστούν.

Για την ακρίβεια, κάθε φορά που ένας ιός καταφέρνει να εισέλθει σε ένα κύτταρό μας, σύντομα το μετατρέπει σε μονάδα παραγωγής ιικών σωματιδίων. Με άλλα λόγια, το κύτταρο αντί να δημιουργεί τις πρωτεΐνες που του χρειάζονται, ασχολείται με τη δημιουργία των πρωτεϊνών του ιού από τις οποίες δημιουργείται το εξωτερικό του περίβλημα, αλλά και με τον πολλαπλασιασμό του ιικού γενετικού υλικού. Στο τέλος, το εξασθενημένο κύτταρο πεθαίνει απελευθερώνοντας εκατομμύρια ιικά σωματίδια έτοιμα να μολύνουν τους επόμενους στόχους τους.

Τυχαία λάθη με… πλεονεκτήματα!

Τα λάθη που κάνουν τα κύτταρά μας αντιγράφοντας το DNA (ιικό ή οικείο) ονομάζονται μεταλλάξεις. Παραδείγματος χάριν, αν στην αλληλουχία ATGCTCTAACGGGATTGACAT είχε γίνει ένα λάθος στη θέση 5 και το Τ είχε αντικατασταθεί από ένα Α θα μιλούσαμε για μετάλλαξη στο σημείο 5 και η αλληλουχία θα γινόταν ATGCΑCTAACGGGATTGACAT. Εκτός όμως από τις σημειακές αυτές μεταλλάξεις υπάρχουν και άλλες, οι οποίες προκύπτουν όταν μεγάλα τμήματα του γενετικού υλικού χάνονται ή και προστίθενται.

Η επίδραση μιας μετάλλαξης σε έναν οργανισμό ποικίλλει: μπορεί να είναι από εντελώς αμελητέα μέχρι εξαιρετικά σοβαρή, ανάλογα με το είδος των αλλαγών που επιφέρει στις πρωτεΐνες. Στον άνθρωπο, μεταλλάξεις ενός και μόνο γράμματος μπορούν να προκαλέσουν σοβαρές ασθένειες. Οι ιοί όμως δεν θεωρούνται ζωντανοί οργανισμοί καθώς δεν μπορούν να αναπαραχθούν χωρίς την ακούσια βοήθεια των ξενιστών τους. Κατά συνέπεια δεν αρρωσταίνουν όταν μεταλλάσσεται το γενετικό υλικό τους! Οι τυχαίες αλλαγές στο γενετικό υλικό μπορούν όμως να είναι κακές, αδιάφορες ή και ευνοϊκές για έναν ιό. Στην πρώτη περίπτωση μπορεί να οδηγήσουν ακόμη και σε άρση της παραγωγής νέων ιικών σωματιδίων. Στην τελευταία περίπτωση μπορεί να προσδώσουν στον ιό αυτό που οι βιολόγοι ονομάζουν εξελικτικό πλεονέκτημα.

Η φυσική επιλογή επί το έργον

Τι θα πει αυτό; Θα πει ότι του χαρίζουν την ικανότητα να πολλαπλασιάζεται περισσότερο! Από τις συγκριτικές μελέτες των γονιδιωμάτων διαφορετικών στελεχών του ιού, οι επιστήμονες γνωρίζουν ότι αυτός μπόρεσε να κυριαρχήσει στον πλανήτη χάρη σε μια μετάλλαξη στη θέση 614 του γονιδιώματός του, η οποία συνέβη στην Κίνα τον Ιανουάριο του 2020. Η μετάλλαξη άλλαξε ένα αμινοξύ στην πρωτεΐνη-ακίδα του ιού καθιστώντας την είσοδό του στα ανθρώπινα κύτταρα πολύ ευκολότερη. Καθοριστικές για τη μεταδοτικότητά τους μεταλλάξεις έχουν συσσωρεύσει και τα νέα στελέχη του ιού, το βρετανικό και το νοτιοαφρικανικό.

Από τα παραπάνω γίνεται φανερό ότι δεν είναι καθόλου περίεργο που υπάρχον ήδη μεταλλαγμένα στελέχη του ιού. Στην πραγματικότητα, για κάθε ιό είναι ζήτημα χρόνου να υπάρξουν νέα στελέχη και όσο περισσότερο εξαπλώνεται ένας ιός τόσο αυξάνει η πιθανότητα συσσώρευσης μεταλλάξεων. Θα ήταν λάθος όμως να θεωρήσουμε ότι ο ιός μεταλλάσσεται για να μας κάνει κακό: ο ιός μεταλλάσσεται τυχαία και όταν κάποιες από αυτές τις αλλαγές ευνοούν τον πολλαπλασιασμό του, επικρατούν. Αυτό που βλέπουμε λοιπόν τώρα με τη βαθμιαία επικράτηση των νέων στελεχών δεν είναι παρά τα αποτελέσματα της φυσικής επιλογής στην πράξη!

Πιθανά σενάρια και μεταδοτικότητα

Δυστυχώς, οι επιστήμονες εκτιμούν ότι ο SARS-CoV-2 θα μπορούσε να αυξήσει περαιτέρω τη μεταδοτικότητά του. Και επειδή η ικανότητα μετάδοσης περνά από την πρωτεΐνη-ακίδα ενάντια στην οποία είναι σχεδιασμένα τα περισσότερα εμβόλια, είναι πολύ πιθανόν σύντομα τα εμβόλια να παρέχουν μερική μόνο προστασία.

Ευτυχώς όμως, αυξημένη μεταδοτικότητα του ιού δεν σημαίνει απαραιτήτως και αυξημένη λοιμοτοξικότητα, ικανότητα δηλαδή να προκαλεί σοβαρή νόσο. Για την ακρίβεια, η φυσική επιλογή θα δρούσε ενάντια στην αυξημένη λοιμοτοξικότητα: όταν ένας ιός σκοτώνει τα θύματά του και μάλιστα σύντομα, ταυτόχρονα θέτει εμπόδια στη δική του εξάπλωση. Είναι λοιπόν δυσκολότερο να επικρατήσουν στελέχη με αυξημένη λοιμοτοξικότητα. Αυτό βεβαίως δεν σημαίνει ότι πρέπει να εφησυχάζουμε. Αντιθέτως απαιτείται επαγρύπνηση και παρακολούθηση των στελεχών που κυκλοφορούν στον πληθυσμό προκειμένου να λαμβάνονται τα κατάλληλα μέτρα την κατάλληλη στιγμή.

Tα πιθανά σενάρια

Ποια θα μπορούσαν να είναι λοιπόν τα πιθανά σενάρια από εδώ και εμπρός; Οι ειδήμονες εκτιμούν ότι ο ιός θα προσαρμοστεί περαιτέρω στον νέο σχετικά ξενιστή του, τον άνθρωπο. Οι προσαρμογές πιθανότατα θα οδηγούν σε αύξηση μεταδοτικότητας και μείωση της λοιμοτοξικότητας, ενώ κάποιες θα προκύψουν από την εξελικτική πίεση που θα ασκείται στον ιό καθώς ολοένα και περισσότεροι άνθρωποι θα εμβολιάζονται ενώ στον πληθυσμό θα αυξάνονται και εκείνοι που έχουν αναρρώσει και φέρουν αντισώματα εναντίον του. Είναι δηλαδή αναμενόμενο να επικρατήσουν τα νέα στελέχη του ιού και πιθανότατα θα υπάρξουν και νέα. Το ενδεχόμενο να απαιτούνται νέα εμβόλια κάθε χρόνο, όπως συμβαίνει με τη γρίπη, είναι πιθανό.

Το πώς λοιπόν θα εξελιχθεί η ζωή μας με τον ιό στο μέλλον εξαρτάται από πολλές παραμέτρους. Καθοριστική μεταξύ αυτών είναι και η ταχύτητα με την οποία θα παράγουμε εμβόλια (και θα εμβολιαζόμαστε!), ενώ για το άμεσο μέλλον είναι σαφές ότι τα μέτρα που ανακόπτουν την επέλαση του ιού (μειώνοντας τις ευκαιρίες του για συσσώρευση μεταλλάξεων) είναι η καλύτερη άμυνα, τόσο σε προσωπικό όσο και σε πληθυσμιακό επίπεδο.

Αλλαγή στο γονιδίωμα κάθε 11 ημέρες

Σήμερα, τα ενεργά κρούσματα του ιού υπολογίζονται παγκοσμίως σε 26 εκατομμύρια περίπου. Αυτό σημαίνει ότι στα κύτταρα 26 εκατομμυρίων ανθρώπων παράγεται ένας ασύλληπτα μεγάλος αριθμός ιικών σωματιδίων, κάποια από τα οποία θα φέρουν μεταλλάξεις. Υπολογίζεται ότι στο γονιδίωμα του SARS-CoV-2, το μέγεθος του οποίου είναι 29.829 γράμματα, λαμβάνει χώρα μια αντικατάσταση γράμματος κάθε έντεκα περίπου ημέρες!

Ακολουθήστε στο Google News και μάθετε πρώτοι όλες τις ειδήσεις
Δείτε όλες τις τελευταίες Ειδήσεις από την Ελλάδα και τον Κόσμο, από

Πηγή: tanea.gr

Τελευταία νέα

Γερμανικές εκλογές – Ιστορική ήττα των Χριστιανοδημοκρατών και δύσκολη ευκαιρία για τους Σοσιαλδημοκράτες

Η Άνγκελα Μέρκελ θα ήθελε το τέλος της πολιτικής σταδιοδρομίας της να ήταν κάπως διαφορετικό. Και αυτό γιατί στις...

Θρίλερ δείχνουν τα exit poll στη Γερμανία – Ισοπαλία 25% για Σολτς και Λάσετ

Συνεχίζεται το θρίλερ των γερμανικών εκλογών και με το πρώτο exit poll που δείχνει ισοπαλία για SPD και CDU,...

Γυναικοκτονία στη Ρόδο – Ξεσπά ο αδερφός της αδικοχαμένης Ντόρας – «Ρε κάθαρμα, ρε βλάκα…»

Λίγες ώρες αφότου είπε το τελευταίο «αντίο» στην αδερφή του, ο αδερφός της αδικοχαμένης Ντόρας, ξέσπασε για την δολοφονία της αδερφής...

Γερμανικές εκλογές – Η πρώτη αντίδραση του γερμανού πρέσβη στην Αθήνα

Τα exit poll και τα πρώτα επίσημα αποτελέσματα των γερμανικών εκλογών παρακολούθησε από τον κήπο της γερμανικής πρεσβευτικής κατοικίας...

Συνεχίζεται η οργή κατά Μελισσανίδη: «Κάνατε την ομάδα καφενείο, απολογήσου»

«Ενός κακού, μύρια έπονται» είναι μια φράση που ταιριάζει ταμάμ στην περίπτωση της ΑΕΚ! Μετά τον τέταρτο χαμένο τελικό,...

Κυκλοφοριακές ρυθμίσεις στον Ασπρόπυργο λόγω φωτιάς σε αποθήκη ξυλείας

Κυκλοφοριακές ρυθμίσεις πραγματοποιεί η ΕΛΑΣ στην ευρύτερη περιοχή του Ασπρόπυργου Αττικής, λόγω της πυρκαγιάς που είναι σε εξέλιξη σε...

Πρέπει να διαβάσετε

Μπορεί επίσης να σας αρέσειΣΧΕΤΙΖΕΤΑΙ ΜΕ
Συνιστάται σε εσάς